Stem-loop sequence dvi-mir-315a

AccessionMI0009510 (change log)
DescriptionDrosophila virilis miR-315a stem-loop
Gene family MIPF0000141; mir-315
Stem-loop
      c   auca               a       cu cau 
5' cgc uau    uuuugauuguugcuc gaaagcc  g   u
   ||| |||    ||||||||||||||| |||||||  |   c
3' gcg aua    aaagcuaauaaugag cuuucgg  c   a
      a   aacc               -       uu aua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 18083590-18083671 [-]
intergenic
Database links

Mature sequence dvi-miR-315a

Accession MIMAT0008944
Sequence

12 - 

uuuugauuguugcucagaaagcc

 - 34

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).