Stem-loop sequence dvi-mir-316

AccessionMI0009512 (change log)
DescriptionDrosophila virilis miR-316 stem-loop
Gene family MIPF0000254; mir-316
Stem-loop
         -    c   u           g   -a   g    uua 
5' aaguuc uagu gau ugucuuuuucc cuu  cug cguu   u
   |||||| |||| ||| ||||||||||| |||  ||| ||||   u
3' uuuaag auca uua gcggaaaaagg gaa  gac gcaa   g
         u    u   u           -   ag   a    cga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 24266839-24266926 [+]
intergenic
Database links

Mature sequence dvi-miR-316-5p

Accession MIMAT0008945
Previous IDsdvi-miR-316
Sequence

16 - 

ugucuuuuuccgcuuacugg

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-316-3p

Accession MIMAT0032071
Sequence

53 - 

acaggaaagggaaaaaggcgua

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).