Stem-loop sequence dvi-mir-317

AccessionMI0009515 (change log)
DescriptionDrosophila virilis miR-317 stem-loop
Gene family MIPF0000144; mir-317
Stem-loop
   ug    u         aua    --     c     uugaau   g 
5'   caau gccgcuggg   cacc  cugug ucgcu      ugu c
     |||| |||||||||   ||||  ||||| |||||      |||  
3'   guug cggugaccu   gugg  gacac aguga      acg a
   cg    c         aug    uc     a     ------   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 2698541-2698626 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-317
dvi-mir-317scaffold_12855: 2698541-2698626 [-]
dvi-mir-9716scaffold_12855: 2693707-2693761 [-]
Database links

Mature sequence dvi-miR-317-5p

Accession MIMAT0032073
Sequence

13 - 

ugggauacacccugugcucgcu

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-317-3p

Accession MIMAT0008947
Previous IDsdvi-miR-317
Sequence

53 - 

ugaacacagcuggugguauccagu

 - 76

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).