Stem-loop sequence dvi-mir-184

AccessionMI0009516 (change log)
DescriptionDrosophila virilis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -     -c    c  u  ua         -     gcgccccgugugcau 
5'  uuggc  ggug au cg  cccuuauca uucuc               a
    |||||  |||| || ||  ||||||||| |||||                
3'  aacug  ccac ua gc  gggaauagu aagag               u
   c     aa    -  u  uc         c     gcaggucaacagauc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 243293-243390 [+]
intergenic
Database links

Mature sequence dvi-miR-184-5p

Accession MIMAT0008948
Previous IDsdvi-miR-184*
Sequence

20 - 

ccuuaucauucucgcgccccgu

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-184-3p

Accession MIMAT0008949
Previous IDsdvi-miR-184
Sequence

59 - 

uggacggagaacugauaagggc

 - 80

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).