Stem-loop sequence dvi-mir-184

AccessionMI0009516 (change log)
DescriptionDrosophila virilis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   -     -c    c  u  ua         -     gcgccccgugugcau 
5'  uuggc  ggug au cg  cccuuauca uucuc               a
    |||||  |||| || ||  ||||||||| |||||                
3'  aacug  ccac ua gc  gggaauagu aagag               u
   c     aa    -  u  uc         c     gcaggucaacagauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 243293-243390 [+]
intergenic
Database links

Mature sequence dvi-miR-184-5p

Accession MIMAT0008948
Previous IDsdvi-miR-184*
Sequence

20 - 

ccuuaucauucucgcgccccgu

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-184-3p

Accession MIMAT0008949
Previous IDsdvi-miR-184
Sequence

59 - 

uggacggagaacugauaagggc

 - 80

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).