Stem-loop sequence dvi-mir-286

AccessionMI0009517 (change log)
DescriptionDrosophila virilis miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --         aaug    u   -    a          uucaaaca     cca 
5'   uuaaaauua    gcga ugu cggu uggucgcuuu        auaua   u
     |||||||||    |||| ||| |||| ||||||||||        |||||    
3'   aauuuuaau    ugcu aca gcca aucagugaaa        uauau   u
   aa         aucg    c   a    g          --------     cua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 4112127-4112227 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-286
dvi-mir-309scaffold_12875: 4111809-4111882 [+]
dvi-mir-3scaffold_12875: 4111962-4112026 [+]
dvi-mir-286scaffold_12875: 4112127-4112227 [+]
dvi-mir-4scaffold_12875: 4112313-4112393 [+]
dvi-mir-5scaffold_12875: 4112468-4112537 [+]
dvi-mir-6-1scaffold_12875: 4112632-4112701 [+]
dvi-mir-6-2scaffold_12875: 4112784-4112863 [+]
dvi-mir-6-3scaffold_12875: 4112960-4113032 [+]
Database links

Mature sequence dvi-miR-286-5p

Accession MIMAT0032074
Sequence

13 - 

ggcgauugucgguauggucgc

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-286-3p

Accession MIMAT0008950
Previous IDsdvi-miR-286
Sequence

67 - 

ugacuagaccgaacacucgugcu

 - 89

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).