Stem-loop sequence dvi-mir-34

AccessionMI0009523 (change log)
DescriptionDrosophila virilis miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention dvi-mir-34
(1 sentences)

Stem-loop
   ug   a  -   uu        u  u   c        --ug c a 
5'   gcu ug cgc  uggcagug gg uag ugguugug    g c a
     ||| || |||  |||||||| || ||| ||||||||    | |  
3'   cga ac gcg  gccgucac uc auc accgacac    c g u
   --   -  a   cc        u  u   -        uaaa a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 2682554-2682640 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-34
dvi-mir-277scaffold_12855: 2684222-2684310 [-]
dvi-mir-34scaffold_12855: 2682554-2682640 [-]
Database links

Mature sequence dvi-miR-34-5p

Accession MIMAT0008955
Previous IDsdvi-miR-34
Sequence

14 - 

uggcagugugguuagcugguu

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-34-3p

Accession MIMAT0032078
Sequence

56 - 

cagccacuaucuucacugccgcc

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).