Stem-loop sequence dvi-mir-4

AccessionMI0009524 (change log)
DescriptionDrosophila virilis miR-4 stem-loop
Gene family MIPF0000305; mir-4
Stem-loop
    ug    u gu   uu    c   c   cuuag      u 
5' u  caau a  uuc  uggu guc agc     gugauu c
   |  |||| |  |||  |||| ||| |||     |||||| u
3' g  guug u  aag  acca cag ucg     uacuag c
    gu    c ug   uu    a   a   --aaa      u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 4112313-4112393 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-4
dvi-mir-309scaffold_12875: 4111809-4111882 [+]
dvi-mir-3scaffold_12875: 4111962-4112026 [+]
dvi-mir-286scaffold_12875: 4112127-4112227 [+]
dvi-mir-4scaffold_12875: 4112313-4112393 [+]
dvi-mir-5scaffold_12875: 4112468-4112537 [+]
dvi-mir-6-1scaffold_12875: 4112632-4112701 [+]
dvi-mir-6-2scaffold_12875: 4112784-4112863 [+]
dvi-mir-6-3scaffold_12875: 4112960-4113032 [+]
Database links

Mature sequence dvi-miR-4-5p

Accession MIMAT0032079
Sequence

13 - 

ucuuuggucguccagccuuaggug

 - 36

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-4-3p

Accession MIMAT0008956
Previous IDsdvi-miR-4
Sequence

49 - 

auaaagcuagacaaccauuga

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).