Stem-loop sequence dvi-mir-309

AccessionMI0009526 (change log)
DescriptionDrosophila virilis miR-309 stem-loop
Gene family MIPF0000140; mir-3
Literature search

2 open access papers mention dvi-mir-309
(15 sentences)

Stem-loop
           gu      ug      uu   cag  u u 
5' auuauaug  aaacuu  uucagu  ugc   gc c u
   ||||||||  ||||||  ||||||  |||   || | u
3' uaauaugc  uuugaa  ggguca  acg   cg g u
           ug      gu      cu   ---  u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 4111809-4111882 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-309
dvi-mir-309scaffold_12875: 4111809-4111882 [+]
dvi-mir-3scaffold_12875: 4111962-4112026 [+]
dvi-mir-286scaffold_12875: 4112127-4112227 [+]
dvi-mir-4scaffold_12875: 4112313-4112393 [+]
dvi-mir-5scaffold_12875: 4112468-4112537 [+]
dvi-mir-6-1scaffold_12875: 4112632-4112701 [+]
dvi-mir-6-2scaffold_12875: 4112784-4112863 [+]
dvi-mir-6-3scaffold_12875: 4112960-4113032 [+]
Database links

Mature sequence dvi-miR-309-5p

Accession MIMAT0032081
Sequence

7 - 

ugguaaacuuuguucaguuuug

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-309-3p

Accession MIMAT0008958
Previous IDsdvi-miR-309
Sequence

49 - 

ucacugggugaaguuugucgua

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).