Stem-loop sequence dvi-mir-1

AccessionMI0009527 (change log)
DescriptionDrosophila virilis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention dvi-mir-1
(3 sentences)

Stem-loop
   --   uuu  --ga            c        aaua    u aa 
5'   gcc   ga    guuccaugcuuc uuacauuc    guau c  a
     |||   ||    |||||||||||| ||||||||    |||| |   
3'   cgg   cu    cgagguaugaag aauguaag    uaua g  u
   ag   --u  aaag            a        ---g    c aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 13613429-13613515 [-]
intergenic
Database links

Mature sequence dvi-miR-1-5p

Accession MIMAT0032082
Sequence

14 - 

ccaugcuuccuuacauucaaua

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-1-3p

Accession MIMAT0008959
Previous IDsdvi-miR-1
Sequence

53 - 

uggaauguaaagaaguauggag

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).