Stem-loop sequence dvi-bantam

AccessionMI0009533 (change log)
DescriptionDrosophila virilis bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

1 open access papers mention dvi-bantam
(3 sentences)

Stem-loop
   au     uac    c          uu      g   -      
5'   uugac   gaaa cgguuuucga  ugguuu acu guauu 
     |||||   |||| ||||||||||  |||||| ||| |||| u
3'   aacug   uuuu gucgaaaguu  acuaga uga cauac 
   --     ---    a          uu      g   a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 5805321-5805401 [+]
intergenic
Database links

Mature sequence dvi-bantam-5p

Accession MIMAT0032086
Sequence

15 - 

ccgguuuucgauuugguuugacu

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-bantam-3p

Accession MIMAT0008966
Previous IDsdvi-bantam
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).