Stem-loop sequence dvi-mir-31a

AccessionMI0009534 (change log)
DescriptionDrosophila virilis miR-31a stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention dvi-mir-31a
(1 sentences)

Stem-loop
          uuc       a     u         ----------  a    u 
5' ucuguug   aauuggc agaug cggcauagc          ug cguu g
   |||||||   ||||||| ||||| |||||||||          || ||||  
3' agguaac   uugacug ucuac gucguaucg          ac gcga a
          uua       a     -         cgauauuuuu  -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 16937665-16937756 [-]
intergenic
Database links

Mature sequence dvi-miR-31a-5p

Accession MIMAT0008967
Previous IDsdvi-miR-31a
Sequence

14 - 

uggcaagaugucggcauagcuga

 - 36

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-31a-3p

Accession MIMAT0032087
Sequence

60 - 

cgcuaugcugcaucuagucagu

 - 81

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).