Stem-loop sequence dvi-mir-31b

AccessionMI0009540 (change log)
DescriptionDrosophila virilis miR-31b stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention dvi-mir-31b
(1 sentences)

Stem-loop
        -    aau     a     uc  a       agagcacaaagucauaaauccagaauu 
5' caaau aaug   uuggc agaug  gg auagcug                           u
   ||||| ||||   ||||| |||||  || |||||||                            
3' guuua uuac   aacug ucuac  cc uaucggc                           c
        c    guu     a     -u  g       gacaugaguuauuuuuauguguuuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12726: 2775754-2775879 [-]
intergenic
Database links

Mature sequence dvi-miR-31b

Accession MIMAT0008972
Sequence

14 - 

uggcaagaugucggaauagcu

 - 34

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).