Stem-loop sequence bta-mir-124b

AccessionMI0009726 (change log)
Previous IDsbta-mir-104-3
DescriptionBos taurus miR-124b stem-loop
Gene family MIPF0000021; mir-124
Literature search

8 open access papers mention bta-mir-124b
(10 sentences)

Stem-loop 
   u    -   c    - c        a   ga        uaaug 
5'  gagg gcc cucu g guguucac gcg  ccuugauu     u
    |||| ||| |||| | |||||||| |||  ||||||||      
3'  cucc cgg gaga c cguaagug cgc  ggaauuaa     c
   c    g   a    a -        g   ac        cauau
Get sequence
Deep sequencing
193 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was mis-named bta-mir-104-3 in [1].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 55046824-55046910 [-]
intergenic
Database links

Mature sequence bta-miR-124b

Accession MIMAT0013774
Sequence

53 -  

uaaggcacgcggugaaugccaag

 - 75

Get sequence
Deep sequencing192 reads, 50 experiments
Evidence experimental; cloned [2], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).