![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-124b |
|||||
Accession | MI0009726 (change log) | ||||
Previous IDs | bta-mir-104-3 | ||||
Description | Bos taurus miR-124b stem-loop | ||||
Gene family | MIPF0000021; mir-124 | ||||
Literature search |
![]()
8 open access papers mention bta-mir-124b | ||||
Stem-loop |
u - c - c a ga uaaug 5' gagg gcc cucu g guguucac gcg ccuugauu u |||| ||| |||| | |||||||| ||| |||||||| 3' cucc cgg gaga c cguaagug cgc ggaauuaa c c g a a - g ac cauau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was mis-named bta-mir-104-3 in [1]. |
||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-124b |
|
Accession | MIMAT0013774 |
Sequence |
53 - uaaggcacgcggugaaugccaag - 75 |
Deep sequencing | 192 reads, 50 experiments |
Evidence | experimental; cloned [2], Array [3], qRT-PCR [3] |
Predicted targets |
|
References |
|
1 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
2 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
3 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|