Stem-loop sequence bta-mir-24-1

Accession

MI0009761 (change log)

Description

Bos taurus miR-24-1 stem-loop

Gene family

MIPF0000041; mir-24

Literature search

24 open access papers mention bta-mir-24-1
(51 sentences)

Stem-loop

       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacau 

Deep sequencing

86489 reads, 561 reads per million, 75 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr8: 83484370-83484437 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000065565 ; intron 6

  antisense

  ENSBTAT00000042333 ; bta-mir-24-1-201; exon 1

Clustered miRNAs

< 10kb from bta-mir-24-1

• bta-mir-2475: chr8: 83482947-83483017 [+]
• bta-mir-10174: chr8: 83483597-83483678 [+]
• bta-mir-27b: chr8: 83483816-83483912 [+]
• bta-mir-24-1: chr8: 83484370-83484437 [+]

Database links

• EntrezGene:MIR24-1
• miRBase Tracker:MI0009761

Mature sequence bta-miR-24

• Accession: MIMAT0009250
• Sequence: 6 - gugccuacugagcugauaucagu - 28
• Deep sequencing: 414 reads, 63 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • TargetScanVert:bta-miR-24

References

1. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).