![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-24-1 |
||||||||||
Accession | MI0009761 (change log) | |||||||||
Description | Bos taurus miR-24-1 stem-loop | |||||||||
Gene family | MIPF0000041; mir-24 | |||||||||
Literature search |
![]()
24 open access papers mention bta-mir-24-1 | |||||||||
Stem-loop |
g g a ua ucuca 5' cucc gu ccu cugagcuga ucagu u |||| || ||| ||||||||| ||||| u 3' gagg ca gga gacuugacu gguca u a a c -c cacau |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence bta-miR-24 |
|
Accession | MIMAT0009250 |
Sequence |
6 - gugccuacugagcugauaucagu - 28 |
Deep sequencing | 414 reads, 63 experiments |
Evidence | experimental; cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
2 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|