![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-218-1 |
|||||
Accession | MI0009780 (change log) | ||||
Previous IDs | bta-mir-218a | ||||
Description | Bos taurus miR-218-1 stem-loop | ||||
Gene family | MIPF0000026; mir-218 | ||||
Literature search |
5 open access papers mention bta-mir-218-1 | ||||
Stem-loop |
- uuau a a u u cu gg - g 5' gugg gu gcg gau uucugu gugcuugau aaccaugu uugc ca g |||| || ||| ||| |||||| ||||||||| |||||||| |||| || 3' cauc cg cgc cug aaggua cacgaacug uugguaca aaug gu u a -uuu a a c c cc -a a a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-218 |
|
Accession | MIMAT0003798 |
Sequence |
25 - uugugcuugaucuaaccaugug - 46 |
Deep sequencing | 10958 reads, 64 experiments |
Evidence | experimental; cloned [1,3-4] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|
4 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|