Stem-loop sequence bta-mir-218-1

AccessionMI0009780 (change log)
Previous IDsbta-mir-218a
DescriptionBos taurus miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

5 open access papers mention bta-mir-218-1
(7 sentences)

Stem-loop 
   -    uuau  a   a   u      u         cu        gg    -  g 
5'  gugg    gu gcg gau uucugu gugcuugau  aaccaugu  uugc ca g
    ||||    || ||| ||| |||||| |||||||||  ||||||||  |||| ||  
3'  cauc    cg cgc cug aaggua cacgaacug  uugguaca  aaug gu u
   a    -uuu  a   a   c      c         cc        -a    a  a
Get sequence
Deep sequencing
5691 reads, 9.09 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 41756487-41756596 [+]
sense
ENSBTAT00000061059 ; SLIT2-201; intron 16
Database links

Mature sequence bta-miR-218

Accession MIMAT0003798
Sequence

25 -  

uugugcuugaucuaaccaugug

 - 46

Get sequence
Deep sequencing10958 reads, 64 experiments
Evidence experimental; cloned [1,3-4]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).