![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-302d |
||||||||||||
Accession | MI0009792 (change log) | |||||||||||
Description | Bos taurus miR-302d stem-loop | |||||||||||
Gene family | MIPF0000071; mir-302 | |||||||||||
Literature search |
![]()
4 open access papers mention bta-mir-302d | |||||||||||
Stem-loop |
c c uu -----c a 5' cu uacu aacauggaggcacuug ugug c || |||| |||||||||||||||| |||| 3' gg guga uuguaccuucgugaau auac u - c uu aaaaaa u |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
Mature sequence bta-miR-302d |
|
Accession | MIMAT0009279 |
Sequence |
46 - uaagugcuuccauguuuuagu - 66 |
Deep sequencing | 4 reads, 4 experiments |
Evidence | by similarity; MI0010353 |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|