![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-483 |
|||||
Accession | MI0009841 (change log) | ||||
Description | Bos taurus miR-483 stem-loop | ||||
Gene family | MIPF0000180; mir-483 | ||||
Literature search |
2 open access papers mention bta-mir-483 | ||||
Stem-loop |
- a a g c ug u g 5' ggggagggcggga ga aggag g g g cu u ||||||||||||| || ||||| | | | || 3' ccucuucugcccu cu uccuc c c c ga g u c c a u cu - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-483 |
|
Accession | MIMAT0009327 |
Sequence |
43 - ucacuccucuccucccgucuu - 63 |
Deep sequencing | 748 reads, 55 experiments |
Evidence | by similarity; MI0010400 |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|