![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-491 |
|||||
Accession | MI0009846 (change log) | ||||
Description | Bos taurus miR-491 stem-loop | ||||
Gene family | MIPF0000319; mir-491 | ||||
Literature search |
1 open access papers mention bta-mir-491 | ||||
Stem-loop |
ug cu u cc c a 5' u acuuag ggguag ggggaa cuu caugaggagu g | |||||| |||||| |||||| ||| |||||||||| a 3' g uggguc uccauc ucccuu gaa guauuccuca a gu ag u -a c c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-491 |
|
Accession | MIMAT0009332 |
Sequence |
16 - aguggggaacccuuccaugagg - 37 |
Deep sequencing | 111 reads, 48 experiments |
Evidence | by similarity; MI0003126 |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|