![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-877 |
||||||
Accession | MI0009903 (change log) | |||||
Description | Bos taurus miR-877 stem-loop | |||||
Gene family | MIPF0000392; mir-877 | |||||
Literature search |
5 open access papers mention bta-mir-877 | |||||
Stem-loop |
gcucgagaa ua au c c ggcuaagac c c 5' gg gaggag gg g aggggacacg uggggg uc c || |||||| || | |||||||||| |||||| || 3' cc cuccuc cc c ucuccugugu accccc ag g gcaugugga -- -- u u ------aca c g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-877 |
|
Accession | MIMAT0009381 |
Sequence |
11 - guagaggagauggcgcaggg - 30 |
Deep sequencing | 1240 reads, 73 experiments |
Evidence | by similarity; MI0005561 |
Predicted targets |
|
References |
|
1 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|