Stem-loop sequence mmu-mir-1930

AccessionMI0009919 (change log)
Symbol MGI:Mir1930
DescriptionMus musculus miR-1930 stem-loop
Literature search

1 open access papers mention mmu-mir-1930
(1 sentences)

Stem-loop
   --   cc         cu        c     g    cuu a 
5'   aug  cacggucac  ccauagua cugca cgug   g c
     |||  |||||||||  |||||||| ||||| ||||   | u
3'   ugc  gugucggug  ggugucau gacgu guau   c u
   cg   uu         uc        u     g    -cu u 
Get sequence
Deep sequencing
415 reads, 2.5 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 77641224-77641307 [+]
sense
OTTMUST00000098415 ; Ube2g2-004; intron 1
OTTMUST00000098418 ; Ube2g2-005; exon 1
OTTMUST00000098414 ; Ube2g2-001; intron 3
OTTMUST00000098416 ; Ube2g2-003; intron 3
OTTMUST00000098417 ; Ube2g2-002; intron 4
OTTMUST00000098412 ; Sumo3-008; intron 5
ENSMUST00000172813 ; Ube2g2-004; intron 1
ENSMUST00000173360 ; Ube2g2-005; exon 1
ENSMUST00000174510 ; Ube2g2-001; intron 3
ENSMUST00000174546 ; Ube2g2-003; intron 3
ENSMUST00000172772 ; Ube2g2-002; intron 4
ENSMUST00000174113 ; Sumo3-008; intron 5
Database links

Mature sequence mmu-miR-1930-5p

Accession MIMAT0009393
Previous IDsmmu-miR-1930
Sequence

13 - 

accuccauaguaccugcagcgu

 - 34

Get sequence
Deep sequencing376 reads, 76 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1930-3p

Accession MIMAT0017340
Previous IDsmmu-miR-1930*
Sequence

51 - 

ggugcaguuacuguggcugugg

 - 72

Get sequence
Deep sequencing34 reads, 14 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).