Stem-loop sequence mmu-mir-1958

AccessionMI0009955 (change log)
Symbol MGI:Mir1958
DescriptionMus musculus miR-1958 stem-loop
Literature search

1 open access papers mention mmu-mir-1958
(1 sentences)

Stem-loop
   --                                      uuuaauuu 
5'   agccuagaagagaacuuacugcuuccacuuuccuauag        c
     ||||||||||||||||||||||||||||||||||||||        u
3'   uuggaucuucucuugaaugacgaaggugaaaggauauc        a
   cc                                      uuacguca 
Get sequence
Deep sequencing
2028 reads, 12.3 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 48213119-48213215 [-]
sense
OTTMUST00000015705 ; Erp44-001; intron 6
ENSMUST00000030028 ; Erp44-001; intron 6
Database links

Mature sequence mmu-miR-1958

Accession MIMAT0009431
Sequence

61 - 

uaggaaaguggaagcaguaagu

 - 82

Get sequence
Deep sequencing2008 reads, 54 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).