Stem-loop sequence mmu-mir-1962

AccessionMI0009959 (change log)
Symbol MGI:Mir1962
DescriptionMus musculus miR-1962 stem-loop
Literature search

2 open access papers mention mmu-mir-1962
(2 sentences)

Stem-loop
   --  ug  -auuu   a   augua        gug      uc    u        cuc uuc 
5'   ug  gc     gca acu     gucaguca   guccca  uguc gccucucu   g   a
     ||  ||     ||| |||     ||||||||   ||||||  |||| ||||||||   |    
3'   ac  cg     cgu ugg     uagucagu   cagggu  acgg cggagagg   c   g
   ug  gu  ccccu   a   -----        aca      -c    u        uac uuu 
Get sequence
Deep sequencing
90 reads, 44.8 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 135566162-135566282 [+]
sense
ENSMUST00000073961 ; Ptpre-201; intron 1
Database links

Mature sequence mmu-miR-1962

Accession MIMAT0009435
Sequence

73 - 

agaggcuggcacugggacacau

 - 94

Get sequence
Deep sequencing66 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).