Stem-loop sequence mmu-mir-1964

AccessionMI0009961 (change log)
Symbol MGI:Mir1964
DescriptionMus musculus miR-1964 stem-loop
Literature search

1 open access papers mention mmu-mir-1964
(1 sentences)

Stem-loop
   --       g            a  a   c     cc   g 
5'   cuuucuu cgaagcuggagc ca aag cggug  ggu u
     ||||||| |||||||||||| || ||| |||||  ||| g
3'   gaaggaa guuucggccucg gu uuc gccac  ccg a
   ag       g            g  c   a     au   u 
Get sequence
Deep sequencing
11190 reads, 3.41 reads per million, 88 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 29773294-29773376 [+]
sense
OTTMUST00000066973 ; Zfp84-001; intron 2
ENSMUST00000032802 ; Zfp84-001; intron 2
Database links

Mature sequence mmu-miR-1964-5p

Accession MIMAT0017349
Sequence

12 - 

agcuggagcacaaaagccggug

 - 33

Get sequence
Deep sequencing410 reads, 61 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-1964-3p

Accession MIMAT0009437
Previous IDsmmu-miR-1964
Sequence

51 - 

ccgacuucugggcuccggcuuu

 - 72

Get sequence
Deep sequencing10778 reads, 84 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).