Stem-loop sequence sly-MIR156c

AccessionMI0009973 (change log)
DescriptionSolanum lycopersicum miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

33 open access papers mention sly-MIR156c
(155 sentences)

Stem-loop
   u          ua           -uaac       uaauu 
5'  ugacagaaga  gagagcacgaa     gaggugc     g
    ||||||||||  |||||||||||     |||||||      
3'  acuguuuucu  cucucguguuu     uuccacg     g
   u          ua           cuuaa       uacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR157c in [1].

Database links

Mature sequence sly-miR156c

Accession MIMAT0009140
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence by similarity; MI0001771

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).