Stem-loop sequence sly-MIR319a

AccessionMI0009978 (change log)
Previous IDssly-MIR319
DescriptionSolanum lycopersicum miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

23 open access papers mention sly-MIR319a
(161 sentences)

Stem-loop
   -       -         cac       a ga    gu        --  g   ac       uc  aa         ----    a 
5'  gagcuuc uuuagucca   augggga c  uagg  ucaauuug  cu ccg  ucauuca  ca  uguugaggu    cuug u
    ||||||| |||||||||   ||||||| |  ||||  ||||||||  || |||  |||||||  ||  |||||||||    |||| a
3'  cucgagg aagucaggu   uguccuu g  guuc  aguugaac  ga ggc  aguaagu  gu  acgacucca    gagc a
   c       g         uca       c -a    ug        au  g   ga       ga  ca         ccgu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sly-miR319a

Accession MIMAT0009145
Previous IDssly-miR319
Sequence

149 - 

cuuggacugaagggagcucc

 - 168

Get sequence
Evidence by similarity; MI0001782

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).