Stem-loop sequence sko-mir-100

AccessionMI0010161 (change log)
DescriptionSaccoglossus kowalevskii miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --acaac  -    -   u     a     u    c   a      -uua a 
5'        ug gcug gac gugua acccg agau cga cuugug    g g
          || |||| ||| ||||| ||||| |||| ||| ||||||    |  
3'        ac cggu cug cguau ugggu ucua gcu gaacgc    c u
   cuagcga  a    u   c     c     c    c   c      ucgg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL017840.1: 24395-24495 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-100
sko-mir-100GL017840.1: 24395-24495 [-]
sko-let-7GL017840.1: 16470-16570 [-]
Database links

Mature sequence sko-miR-100

Accession MIMAT0009623
Sequence

21 - 

aacccguagauccgaacuugug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).