Stem-loop sequence sko-let-7

AccessionMI0010180 (change log)
DescriptionSaccoglossus kowalevskii let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   guug  g       u     u   g                  agag   ua 
5'     uu ccuacuc cuggg gag uaguagguuguauaguug    cua  c
       || ||||||| ||||| ||| ||||||||||||||||||    |||   
3'     aa ggguggg gaccc uuc aucguucaacaugucaau    ggu  c
   ----  g       -     u   a                  agag   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL017840.1: 16470-16570 [-]
intergenic
Clustered miRNAs
< 10kb from sko-let-7
sko-mir-100GL017840.1: 24395-24495 [-]
sko-let-7GL017840.1: 16470-16570 [-]
Database links

Mature sequence sko-let-7

Accession MIMAT0009644
Sequence

21 - 

ugagguaguagguuguauaguu

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).