Stem-loop sequence spu-let-7

AccessionMI0010185 (change log)
DescriptionStrongylocentrotus purpuratus let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention spu-let-7
(9 sentences)

Stem-loop
   guaca          uuacgu   g         a       -------ug   a 
5'      ugaauggucc      gag uaguagguu uauaguu         gag u
        ||||||||||      ||| ||||||||| |||||||         ||| a
3'      acuuaccggg      uuc aucguccga auaucga         cuc c
   ----c          -uuccu   g         c       uagcgguaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914398.1: 1096279-1096379 [-]
intergenic
Clustered miRNAs
< 10kb from spu-let-7
spu-let-7KN914398.1: 1096279-1096379 [-]
spu-mir-125KN914398.1: 1095315-1095415 [-]
Database links

Mature sequence spu-let-7

Accession MIMAT0009649
Sequence

21 - 

ugagguaguagguuauauaguu

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).