Stem-loop sequence spu-mir-124

AccessionMI0010202 (change log)
DescriptionStrongylocentrotus purpuratus miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention spu-mir-124
(1 sentences)

Stem-loop
   cuucuuauc     -  -u    a            au        uauau 
5'          caucc cg  ucuu guguucacugug  ccuugauu     u
            ||||| ||  |||| ||||||||||||  ||||||||     c
3'          guggg gc  ggaa cguaaguggcgc  ggaauuaa     u
   --cuuuaaa     a  uc    c            ac        caaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914021.1: 463843-463943 [-]
intergenic
Database links

Mature sequence spu-miR-124

Accession MIMAT0009666
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).