Stem-loop sequence cte-mir-1987

AccessionMI0010232 (change log)
Previous IDscap-mir-1987
DescriptionCapitella teleta miR-1987 stem-loop
Stem-loop
   ---aau      u    u    a   uc    ucu 
5'       cacgac uuac ucug gca  uugu   u
         |||||| |||| |||| |||  ||||    
3'       guguug aaug agac cgu  aacg   g
   aagcac      u    u    -   ca    ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB293301.1: 378001-378068 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-1987
cte-mir-2705KB293301.1: 377031-377124 [+]
cte-mir-1987KB293301.1: 378001-378068 [+]
Database links

Mature sequence cte-miR-1987

Accession MIMAT0009703
Previous IDscap-miR-1987
Sequence

42 - 

acugccagauguaauguugugc

 - 63

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).