Stem-loop sequence cla-mir-1992

AccessionMI0010242 (change log)
DescriptionCerebratulus lacteus miR-1992 stem-loop
Gene family MIPF0000705; mir-1992
Stem-loop
   ccuc      c  - ug          guuuu 
5'     caucag gg a  auugcuggua     a
       |||||| || |  ||||||||||      
3'     guaguc cc u  ugacgacuau     u
   -ugu      a  a gu          aaaca 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cla-miR-1992

Accession MIMAT0009713
Sequence

41 - 

ucagcaguuguaccacugaugugu

 - 64

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).