Stem-loop sequence spu-mir-2007

AccessionMI0010277 (change log)
DescriptionStrongylocentrotus purpuratus miR-2007 stem-loop
Gene family MIPF0002094; mir-2007
Literature search

1 open access papers mention spu-mir-2007
(1 sentences)

Stem-loop
   ucg     a       -       c    u  u     --ag   uuu 
5'    gcauc ugcauua uuucagg agua ac gguaa    ggu   a
      ||||| ||||||| ||||||| |||| || |||||    |||   u
3'    uguag acguaau aaagucc ucgu ug ccauu    cca   u
   gug     a       u       a    -  u     cuua   cgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914133.1: 126988-127082 [-]
intergenic
Database links

Mature sequence spu-miR-2007

Accession MIMAT0009748
Sequence

15 - 

uauuucaggcaguauacugguaa

 - 37

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).