Stem-loop sequence spu-mir-2008

AccessionMI0010278 (change log)
DescriptionStrongylocentrotus purpuratus miR-2008 stem-loop
Gene family MIPF0000729; mir-2008
Literature search

1 open access papers mention spu-mir-2008
(8 sentences)

Stem-loop
   uucuc           c      a   a  u        a gaa  u 
5'      cacuuuuuacc cguauu aca ug ggcugaug g   uc u
        ||||||||||| |||||| ||| || |||||||| |   ||  
3'      gugaggaaugg gcauaa ugu gc ccgacuac c   ag a
   -aaca           a      c   c  u        - --a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914988.1: 700461-700552 [+]
intergenic
Database links

Mature sequence spu-miR-2008

Accession MIMAT0009749
Sequence

56 - 

aucagccucgcugucaauacg

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).