Stem-loop sequence cfa-mir-18b

Accession MI0010323
Description Canis familiaris miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        --    u    c   u     -------u    a 
ccuguguu  aagg gcau uag gcagu        agug a
||||||||  |||| |||| ||| |||||        ||||  
ggacacgg  uucc cgua auc cguca        ucgc g
        cc    c    a   c     uccaagau    c 
Get sequence
Genome context
Coordinates (CanFam2) Overlapping transcripts
chrX: 107958044-107958120 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-18b
cfa-mir-106a chrX: 107958223-107958279 [-]
cfa-mir-18b chrX: 107958044-107958120 [-]
cfa-mir-20b chrX: 107957796-107957863 [-]
cfa-mir-19b-2 chrX: 107957667-107957730 [-]
cfa-mir-92a-2 chrX: 107957531-107957591 [-]
cfa-mir-363 chrX: 107957362-107957428 [-]

Mature sequence cfa-miR-18b

Accession MIMAT0009831
Sequence

8 - 

uaaggugcaucuagugcaguua

 - 29

Get sequence
Evidence by similarity; MI0001209
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).