Stem-loop sequence cfa-let-7a-2

AccessionMI0010328 (change log)
DescriptionCanis familiaris let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   c    uguu      uu   g   u             uagaa ua a 
5'  ugca    cccagg  gag uag agguuguauaguu     u  c u
    ||||    ||||||  ||| ||| |||||||||||||     |  | c
3'  acgu    ggguuc  uuc auc uccgacaugucaa     a  g a
   c    -ucu      cu   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr5: 12052786-12052881 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-let-7a-2
cfa-mir-99a-2chr5: 12047369-12047425 [+]
cfa-let-7a-2chr5: 12052786-12052881 [+]
Database links

Mature sequence cfa-let-7a

Accession MIMAT0006594
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Evidence by similarity; MI0000557
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).