Stem-loop sequence cfa-let-7b

AccessionMI0010329 (change log)
DescriptionCanis familiaris let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -     u                     ucagggcagugaug 
5'  cgggg gagguaguagguugugugguu              u
    ||||| |||||||||||||||||||||              u
3'  gcccc uuccgucauccaacauaucaa              g
   a     -                     uagaaggcuccccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr10: 20033388-20033472 [-]
sense
Clustered miRNAs
< 10kb from cfa-let-7b
cfa-let-7a-1chr10: 20034319-20034387 [-]
cfa-let-7bchr10: 20033388-20033472 [-]
Database links

Mature sequence cfa-let-7b

Accession MIMAT0009836
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).