Stem-loop sequence cfa-mir-105b

AccessionMI0010378 (change log)
DescriptionCanis familiaris miR-105b stem-loop
Gene family MIPF0000074; mir-105
Stem-loop
   ugu         u  a          ucc  g    c   u 
5'    gcaucaugg ca augcucagac   uu gugg ugc u
      ||||||||| || ||||||||||   || |||| |||  
3'    ugugguauc gu uacgaguuug   aa uacc acg a
   auc         -  g          --u  g    -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 120405349-120405428 [-]
sense
ENSCAFT00000030424 ; GABRA3-201; intron 1
Clustered miRNAs
< 10kb from cfa-mir-105b
cfa-mir-105bchrX: 120405349-120405428 [-]
cfa-mir-105achrX: 120403195-120403275 [-]
Database links

Mature sequence cfa-miR-105b

Accession MIMAT0010198
Sequence

13 - 

ucaaaugcucagacuccuug

 - 32

Get sequence
Evidence by similarity; MI0002411
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).