Stem-loop sequence cfa-mir-134

AccessionMI0010382 (change log)
DescriptionCanis familiaris miR-134 stem-loop
Gene family MIPF0000112; mir-134
Stem-loop
   c     gu        u  -a   g    gca   a 
5'  agggu  gugacugg ug  cca aggg   agc c
    |||||  |||||||| ||  ||| ||||   ||| u
3'  uccca  cacugauc ac  ggu uccc   uug c
   c     ac        c  cg   g    -ac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69283496-69283568 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-134
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
cfa-mir-496chr8: 69289410-69289507 [+]
cfa-mir-377chr8: 69290937-69291005 [+]
Database links

Mature sequence cfa-miR-134

Accession MIMAT0009883
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Evidence by similarity; MI0000474
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).