Stem-loop sequence cfa-mir-483

AccessionMI0010400 (change log)
DescriptionCanis familiaris miR-483 stem-loop
Gene family MIPF0000180; mir-483
Stem-loop
   -------            aaa      c   - uu  a 
5'        gaggacgggagg   ggagga gug g  uc u
          ||||||||||||   |||||| ||| |  || g
3'        cuucugcccucc   ccuccu cac c  gg c
   ccuucuc            ---      -   u cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr18: 46298392-46298460 [-]
sense
ENSCAFT00000016038 ; IGF2-201; intron 1
ENSCAFT00000044168 ; IGF2-202; intron 2
ENSCAFT00000042947 ; IGF2-203; intron 3
Database links

Mature sequence cfa-miR-483

Accession MIMAT0009901
Sequence

41 - 

ucacuccuccccucccgucuu

 - 61

Get sequence
Evidence by similarity; MI0003484
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).