Stem-loop sequence mtr-MIR2088

AccessionMI0010545 (change log)
Previous IDsmtr-MIR2088
DescriptionMedicago truncatula miR2088 stem-loop
Stem-loop
        gua  uc   guagac  c        c                         aaaac   cca    ug 
5' ucucu   uc  gaa      gg ggcuuaac gauguaggccuagauuacauuggac     agu   aacu  a
   |||||   ||  |||      || |||||||| |||||||||||||||||||||||||     |||   ||||   
3' agaga   ag  cuu      uc cugaauug cuacaucuggaucuaauguaaccug     uca   uugg  g
        --a  -u   augaaa  u        u                         guucu   ---    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 15599389-15599534 [-]
intergenic
Database links

Mature sequence mtr-miR2088-5p

Accession MIMAT0010038
Previous IDsmtr-miR2088;mtr-miR2088a
Sequence

39 - 

aggccuagauuacauuggac

 - 58

Get sequence
Evidence experimental; Illumina [1,3], Northern [1], 454 [2]

Mature sequence mtr-miR2088-3p

Accession MIMAT0010039
Previous IDsmtr-miR2088*;mtr-miR2088a*
Sequence

93 - 

uccaauguaaucuaggucua

 - 112

Get sequence
Evidence experimental; Illumina [1,3], Northern [1], 454 [2]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).