![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1507b |
|||||
Accession | MI0010573 (change log) | ||||
Description | Glycine max miR1507b stem-loop | ||||
Gene family | MIPF0000699; MIR1507 | ||||
Literature search |
![]()
19 open access papers mention gma-MIR1507b | ||||
Stem-loop |
a - a au uauu uc 5' guuug caga gauguauggagugagaga gggaa ga u cgauc ||||| |||| |||||||||||||||||| ||||| || | |||| c 3' caagc gucu cuacauaccuuacucucu cccuu cu a gcuac a g - cu ---c uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1507b |
|
Accession | MIMAT0010080 |
Sequence |
72 - ucucauuccauacaucgucug - 92 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"
Biochem Biophys Res Commun. 378:799-803(2009).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|