Stem-loop sequence gma-MIR1507b

AccessionMI0010573 (change log)
DescriptionGlycine max miR1507b stem-loop
Gene family MIPF0000699; MIR1507
Literature search

19 open access papers mention gma-MIR1507b
(38 sentences)

Stem-loop 
        a    -                  a     au  uauu uc      
5' guuug caga gauguauggagugagaga gggaa  ga    u  cgauc 
   ||||| |||| |||||||||||||||||| |||||  ||    |  |||| c
3' caagc gucu cuacauaccuuacucucu cccuu  cu    a  gcuac 
        a    g                  -     cu  ---c uu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 5926147-5926244 [+]
intergenic
Database links

Mature sequence gma-miR1507b

Accession MIMAT0010080
Sequence

72 -  

ucucauuccauacaucgucug

 - 92

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).