Stem-loop sequence gma-MIR1508b

AccessionMI0010574 (change log)
DescriptionGlycine max miR1508b stem-loop
Gene family MIPF0000719; MIR1508
Literature search

10 open access papers mention gma-MIR1508b
(25 sentences)

Stem-loop
   aauu    uc           -   a      a   -   uuaca      
5'     gcua  caacugcuauu ccc uuucua acc uug     cgagc 
       ||||  ||||||||||| ||| |||||| ||| |||     |||| a
3'     uggu  guugacgauaa ggg aaagau ugg aac     guucu 
   uucg    ga           a   -      c   u   ---ua      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR1508b

Accession MIMAT0010081
Sequence

65 - 

uagaaagggaaauagcaguug

 - 85

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).