Stem-loop sequence gma-MIR1510b

AccessionMI0010575 (change log)
DescriptionGlycine max miR1510b stem-loop
Gene family MIPF0000703; MIR1510
Literature search

16 open access papers mention gma-MIR1510b
(36 sentences)

Stem-loop 
   uuu      g   a                 u   -u      -  g 
5'    auggaa ugg gggauagguaaaacaac acu  cuguaa aa u
      |||||| ||| ||||||||||||||||| |||  |||||| ||  
3'    uaccuu acc ccuuauccauuuuguug uga  gauauu uu a
   auc      a   a                 u   uu      g  a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 6675723-6675816 [+]
intergenic
Database links

Mature sequence gma-miR1510b-5p

Accession MIMAT0020939
Sequence

14 -  

agggauagguaaaacaacuacu

 - 35

Get sequence
Evidence experimental; Illumina [3-4]

Mature sequence gma-miR1510b-3p

Accession MIMAT0010082
Previous IDsgma-miR1510b
Sequence

63 -  

uguuguuuuaccuauuccacc

 - 83

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [3]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).