![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1510b |
|||||
Accession | MI0010575 (change log) | ||||
Description | Glycine max miR1510b stem-loop | ||||
Gene family | MIPF0000703; MIR1510 | ||||
Literature search |
![]()
16 open access papers mention gma-MIR1510b | ||||
Stem-loop |
uuu g a u -u - g 5' auggaa ugg gggauagguaaaacaac acu cuguaa aa u |||||| ||| ||||||||||||||||| ||| |||||| || 3' uaccuu acc ccuuauccauuuuguug uga gauauu uu a auc a a u uu g a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1510b-5p |
|
Accession | MIMAT0020939 |
Sequence |
14 - agggauagguaaaacaacuacu - 35 |
Evidence | experimental; Illumina [3-4] |
Mature sequence gma-miR1510b-3p |
|
Accession | MIMAT0010082 |
Previous IDs | gma-miR1510b |
Sequence |
63 - uguuguuuuaccuauuccacc - 83 |
Evidence | experimental; cloned [1], 454 [2], Illumina [3] |
References |
|
1 |
PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"
Biochem Biophys Res Commun. 378:799-803(2009).
|
2 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|