Stem-loop sequence gma-MIR2108a

AccessionMI0010577 (change log)
DescriptionGlycine max miR2108a stem-loop
Gene family MIPF0000744; MIR2108
Literature search

1 open access papers mention gma-MIR2108a
(1 sentences)

Stem-loop
           u    uguu    uu     a 
5' cuguguuu aaug    gugu  gucgg a
   |||||||| ||||    ||||  ||||| c
3' gacgcgaa uugu    uaca  uaguc c
           -    -uuu    -u     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 23721868-23721925 [+]
intergenic
Database links

Mature sequence gma-miR2108a

Accession MIMAT0010084
Sequence

8 - 

uuaauguguuguguuugucgg

 - 28

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).