Stem-loop sequence gma-MIR2108b

AccessionMI0010578 (change log)
DescriptionGlycine max miR2108b stem-loop
Gene family MIPF0000744; MIR2108
Literature search

2 open access papers mention gma-MIR2108b
(2 sentences)

Stem-loop
          --ug          - ug    ccccu 
5' guuuuaa    uguuguguuu g  agaa     g
   |||||||    |||||||||| |  ||||      
3' cgggauu    gcgacgcgaa u  uuuu     a
          uuga          u gu    acauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 19284064-19284130 [+]
intergenic
Database links

Mature sequence gma-miR2108b

Accession MIMAT0010085
Sequence

4 - 

uuaauguguuguguuugugag

 - 24

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).