Stem-loop sequence lja-MIR167

AccessionMI0010580 (change log)
DescriptionLotus japonicus miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
   guuc    -a  -ug      u           gc        ag      uucuu 
5'     gugc  cc   caauag ugaagcugcca  augaucug  cuuacc     g
       ||||  ||   |||||| |||||||||||  ||||||||  ||||||     u
3'     uacg  gg   guuguc acuucgacggu  uacuagac  gaaugg     a
   ----    aa  uaa      c           -a        aa      uaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lja-miR167

Accession MIMAT0010087
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Evidence by similarity; MI0010571

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).