Stem-loop sequence lja-MIR396

AccessionMI0010581 (change log)
DescriptionLotus japonicus miR396 stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   gu   c       uc            c          ---uucaau  -    c 
5'   ccu uuuguau  uuccacagcuuu uugaacugca         ug caug a
     ||| |||||||  |||||||||||| ||||||||||         || |||| u
3'   gga agauaua  agggugucgaaa aacuuggcgu         ac guac g
   -g   u       ga            u          uuuauucuc  a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lja-miR396

Accession MIMAT0010088
Sequence

16 - 

uuccacagcuuucuugaacug

 - 36

Get sequence
Evidence by similarity; MI0010572

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).