Stem-loop sequence vun-MIR1507a

AccessionMI0010582 (change log)
Previous IDsvun-MIR1507
DescriptionVigna unguiculata miR1507a stem-loop
Gene family MIPF0000699; MIR1507
Literature search

1 open access papers mention vun-MIR1507a
(1 sentences)

Stem-loop
     a ua    g    -                  a        c ccuuu        
5' gu g  uuug caga gguguauggagugagaga gggaaaaa g     gccgauc 
   || |  |||| |||| |||||||||||||||||| |||||||| |     |||||| u
3' cg u  aagc gucu cuacauaccuuacucucu ccuuuuuu c     uggcuac 
     a gc    a    g                  -        u ----u        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence vun-miR1507a

Accession MIMAT0010089
Previous IDsvun-miR1507
Sequence

78 - 

ucucauuccauacaucgucug

 - 98

Get sequence
Evidence by similarity; MI0007219

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).