Stem-loop sequence aga-mir-190

AccessionMI0010594 (change log)
DescriptionAnopheles gambiae miR-190 stem loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention aga-mir-190
(1 sentences)

Stem-loop
   uguuuggugg       u      -            au      u  u   gau 
5'           gacaguu cgguga gauauguuugau  ucuugg ug uaa   u
             ||||||| |||||| ||||||||||||  |||||| || |||    
3'           cugucag gccauu uuauacaaacua  aggacc ac auu   u
   --------ug       u      a            --      c  u   aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2L: 46755772-46755872 [-]
intergenic
Database links

Mature sequence aga-miR-190

Accession MIMAT0010100
Sequence

24 - 

agauauguuugauauucuugguug

 - 47

Get sequence
Evidence by similarity; MI0005808

References

1
" Griffiths-Jones S Unpublished (2009).