Stem-loop sequence aga-mir-929

AccessionMI0010595 (change log)
DescriptionAnopheles gambiae miR-929 stem loop
Gene family MIPF0000447; mir-929
Literature search

1 open access papers mention aga-mir-929
(1 sentences)

Stem-loop
   -----c    gcg         a        ag         -   uu 
5'       cuac   ugggauuaa uugacucu  uagggaguc cuu  a
         ||||   ||||||||| ||||||||  ||||||||| |||   
3'       gaug   gccuuaguu gacugagg  aucccucag gag  u
   ccacgu    ---         a        ca         c   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2R: 38819434-38819522 [-]
intergenic
Database links

Mature sequence aga-miR-929

Accession MIMAT0010101
Sequence

53 - 

cucccuaacggagucagauug

 - 73

Get sequence
Evidence by similarity; MI0005853

References

1
" Griffiths-Jones S Unpublished (2009).